View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11330_low_1 (Length: 412)
Name: NF11330_low_1
Description: NF11330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11330_low_1 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 223 - 412
Target Start/End: Original strand, 49985359 - 49985548
Alignment:
| Q |
223 |
actttcgttaaaaataacttgttttgaaattggggttttggaaaacggttgggtatgaattatttttgaattagtgtatgagtgattaagggttttggaa |
322 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49985359 |
acttttgttaaaaataacttgttttgaaattggggttttggaaaacggttgggtatgaattatttttgaattagtgcatgagtgattaagggttttggaa |
49985458 |
T |
|
| Q |
323 |
agaggttttaagcgctgaaagtttctttttcagttttggttttgtgaaacagtcagaggtagtagacacagattatgttgatagtgagac |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49985459 |
agaggttttaagcgctgaaagtttctttttcagttttggttttgtgaaacagtcagaggtagtagacacagattatgttgatagtgagac |
49985548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 17 - 139
Target Start/End: Original strand, 49985153 - 49985276
Alignment:
| Q |
17 |
acatcaatccttgtattgtatcgcacacgaattcacattcagtcgcactttcatcgctggaatcaacttcaccttctttctgaacctgtagtctcactat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49985153 |
acatcaatccttgtattgtatcgcacacgaattcacattcagtcgcacgttcatcgctggaatcaacttcaccttctttctgaacctgtagtctcactat |
49985252 |
T |
|
| Q |
117 |
ctctcgaactgaa-ttatcgactg |
139 |
Q |
| |
|
||||| ||||||| |||||||||| |
|
|
| T |
49985253 |
ctctcaaactgaatttatcgactg |
49985276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University