View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11331_high_3 (Length: 424)

Name: NF11331_high_3
Description: NF11331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11331_high_3
NF11331_high_3
[»] chr5 (1 HSPs)
chr5 (19-424)||(3332102-3332507)
[»] chr8 (1 HSPs)
chr8 (273-353)||(13212814-13212894)
[»] chr1 (3 HSPs)
chr1 (303-351)||(32803230-32803278)
chr1 (303-351)||(16578617-16578665)
chr1 (316-351)||(32809703-32809738)
[»] chr3 (1 HSPs)
chr3 (290-343)||(46200911-46200964)


Alignment Details
Target: chr5 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 19 - 424
Target Start/End: Original strand, 3332102 - 3332507
Alignment:
19 ctaaatatatggtcaaaccagaagcagcgggcggagcaggtggtggaagaaacgatccagccagcgaaagaatctcgaaccttccatgaagtgtaacaac 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3332102 ctaaatatatggtcaaaccagaagcagcgggcggagcaggtggtggaagaaacgatccagccagcgaaagaatctcgaaccttccatgaagtgtaacaac 3332201  T
119 agccccaggagaagccggttgccttagtgtcacgtttgtaaccgtccctgtcccactcatgatgcaaacgcctctttgacggcgtctagcaaagttgttg 218  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
3332202 agctccaggagaagccggttgccttagtgtcacgtttgtaaccgtccctgtcccactcatgatgcaaacgcctctttgacggcgtctagcgaagttgttg 3332301  T
219 acactttcaacaacgtcacaaccgtctgcaacttccatcacgtgagttttcaaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgt 318  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3332302 acactttcaacaacgtcacaaccgtctgcaacttccatcacgtgagttttcaaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgt 3332401  T
319 ttttggatccagctggtcttcctcttggtcttcttgtcattgaatcggtgtcgccaccggaaccacctcctccggattctaccttggggctaaaatctgt 418  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
3332402 ttttggatccagctggtcttcctcttggtcttcttgtcattgaatcggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgt 3332501  T
419 gctgaa 424  Q
    ||||||    
3332502 gctgaa 3332507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 273 - 353
Target Start/End: Original strand, 13212814 - 13212894
Alignment:
273 gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttctt 353  Q
    ||||| |||||||| |  |||||||| || |||||||||||||||||||| || || ||||||||||||||||||||||||    
13212814 gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttctt 13212894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 303 - 351
Target Start/End: Original strand, 32803230 - 32803278
Alignment:
303 ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 351  Q
    |||||||||||| ||||||||||||||| ||||||||||||||||||||    
32803230 ggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc 32803278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 303 - 351
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
303 ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 351  Q
    |||||||||||||||||||| || || | ||||||||||||||||||||    
16578665 ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc 16578617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 316 - 351
Target Start/End: Original strand, 32809703 - 32809738
Alignment:
316 tgtttttggatccagctggtcttcctcttggtcttc 351  Q
    ||||||||||||||| ||||||||||||||||||||    
32809703 tgtttttggatccaggtggtcttcctcttggtcttc 32809738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 343
Target Start/End: Complemental strand, 46200964 - 46200911
Alignment:
290 tgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctct 343  Q
    |||||||||||| |||||||||||||||||||| || |||| ||| | ||||||    
46200964 tgtgatgataataggtggttttggtttgttttttgagccaggtggacgtcctct 46200911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University