View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11331_low_10 (Length: 289)

Name: NF11331_low_10
Description: NF11331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11331_low_10
NF11331_low_10
[»] chr3 (1 HSPs)
chr3 (18-228)||(53024323-53024542)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 53024542 - 53024323
Alignment:
18 ctttctaccaatttctttttactattgttattacactaaattttggcaaccatggaaacaaagtggcagtttcaaagc---------aactaaaaatgac 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||    
53024542 ctttctaccaatttctttttactattgttattacactaaattttggcaaccatggaaacaaagtggcagtttcaaagcgttaaggacaactaaaaatgac 53024443  T
109 gcgtatggttttgtcaaaccttccttccattgctataaacgtagccacttcaacaaactattgtgtctgtcattttcccactgaatggaagaaagaattg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
53024442 gcgtatggttttgtcaaaccttccttccattgctataaacgtagccacttcaacaaactatggtgtctgtcattttcccactgaatggaagaaagaattg 53024343  T
209 ttttagcaatattccatcca 228  Q
    ||||||||||||||||||||    
53024342 ttttagcaatattccatcca 53024323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University