View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11331_low_10 (Length: 289)
Name: NF11331_low_10
Description: NF11331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11331_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 53024542 - 53024323
Alignment:
| Q |
18 |
ctttctaccaatttctttttactattgttattacactaaattttggcaaccatggaaacaaagtggcagtttcaaagc---------aactaaaaatgac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53024542 |
ctttctaccaatttctttttactattgttattacactaaattttggcaaccatggaaacaaagtggcagtttcaaagcgttaaggacaactaaaaatgac |
53024443 |
T |
 |
| Q |
109 |
gcgtatggttttgtcaaaccttccttccattgctataaacgtagccacttcaacaaactattgtgtctgtcattttcccactgaatggaagaaagaattg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53024442 |
gcgtatggttttgtcaaaccttccttccattgctataaacgtagccacttcaacaaactatggtgtctgtcattttcccactgaatggaagaaagaattg |
53024343 |
T |
 |
| Q |
209 |
ttttagcaatattccatcca |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
53024342 |
ttttagcaatattccatcca |
53024323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University