View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11331_low_13 (Length: 214)
Name: NF11331_low_13
Description: NF11331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11331_low_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 39123556 - 39123769
Alignment:
| Q |
1 |
cattttaaggcgtgtaactctgtgttcacttcacatattaatgtgataattatatgtaaaactgtgaagaatttttggaaagttttttatatatacattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39123556 |
cattttaaggcgtgtaactctgtgttcacttcacatattaatgtgataattatatgtaaaactgtgaagaatttttggaaagttttttatatatacattg |
39123655 |
T |
 |
| Q |
101 |
tttggagtctgctgcatgtttaacattagacggagctttctttctaattgtgctttagattctgaaaaggaactcaatactccgattatgcannnnnnna |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39123656 |
tttggagtctgctgcatgtttaacattagacggagctttctttctaattgtgctttagattctgaaaaggaactcaatactccgattatgcattttttta |
39123755 |
T |
 |
| Q |
201 |
tcttccacttttcc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39123756 |
tcttccacttttcc |
39123769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University