View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11332_low_2 (Length: 220)
Name: NF11332_low_2
Description: NF11332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11332_low_2 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 21 - 220
Target Start/End: Original strand, 45143792 - 45143991
Alignment:
| Q |
21 |
taactacaaagtgggcattgaactaacccattttcattacaatcaacacacttaacaacaacagtgttcccctgtttctgtttattcaccatcttacagc |
120 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45143792 |
taactacaaattgggcactgaactaacccattttcattacaatcaccacacttaacaacaacagtgttcccctgtttctgtttattcaccatcttacagc |
45143891 |
T |
|
| Q |
121 |
ttccgttacatcgaaaacaaggcaagaatctcatatcaccacaaccctcacatacacctcctccaccaacagcttttcttggcaaaccctgaataacctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45143892 |
ttccgttacatcgaaaacaaggcaagaatctcatatcaccacaaccctcacatacacctcctccaccaacagcttttcttggcaaaccctgaataacctc |
45143991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University