View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11337_high_12 (Length: 323)
Name: NF11337_high_12
Description: NF11337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11337_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 35 - 303
Target Start/End: Complemental strand, 39502714 - 39502446
Alignment:
| Q |
35 |
catttcgtaaatttgagcaatatgaaagtccaacacaacctttttcttannnnnnnnnggttgagaggagctccaatacaccttaaatatccaccctcac |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
39502714 |
catttcgtaaatttgagcaatatgaaagtccaacacaacctttatcttttttttttttggttgagaggagccccaatacaacttaaatatccaccctcac |
39502615 |
T |
 |
| Q |
135 |
gtttaatgtgagtcacgcacaagtctaattttaatattaaaatcctttacccgattttgatatcatattaaatatatttgaatctcattttaaaagttaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39502614 |
gtttaatgtgagtcacgcacaagtctaatttcaatattaaaatcctttacccgattttgatatcatattaaatatatctgaatctcattttaaaagttaa |
39502515 |
T |
 |
| Q |
235 |
ctcaaatgacggtgtttaaacacatttatacatccaaggaaacatgatcaatgtgaaattccaatacaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
39502514 |
ctcaaatgacggtgtttaaacacatttatacatccatggaaacatgatcaatgtgagattccaatacaa |
39502446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University