View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11337_high_16 (Length: 258)
Name: NF11337_high_16
Description: NF11337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11337_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 135 - 245
Target Start/End: Complemental strand, 40452199 - 40452089
Alignment:
| Q |
135 |
caggaatacttttgtaagtccagaagatgtggttgcacaaactgtgagtggcccaatcttctcccttgtttgtgaattattttcttttctgaattattta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40452199 |
caggaatacttttgtaagtccagaagatgtggttgcacaaactgtgagtggtccaatcttctcccttgtttgtgaattattttcttttctgaatgattta |
40452100 |
T |
|
| Q |
235 |
tgtctctctct |
245 |
Q |
| |
|
||||||||||| |
|
|
| T |
40452099 |
tgtctctctct |
40452089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 40452330 - 40452287
Alignment:
| Q |
1 |
ttaaaatgttttgtgattttgcacactagatttgaagcatatta |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40452330 |
ttaaaatgttttgtgattttgcacactagatttgaagcatatta |
40452287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University