View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11337_high_17 (Length: 242)
Name: NF11337_high_17
Description: NF11337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11337_high_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 242
Target Start/End: Original strand, 10575962 - 10576193
Alignment:
| Q |
11 |
gacatcatgaactattgtaagctattaagttctgtgttgaatattgcatctgtgattaacataatcaccataaattatgttaatcagaacgtcttgtcct |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10575962 |
gacatcatgaactattgtacgctattaagttctgtgttcaatattgcatctgtgattaacataatcaccataaattatgttaatcagaacttcttgtccc |
10576061 |
T |
 |
| Q |
111 |
aacgaagacccacatttttatagtgggtagctcttgccatgctatcttcatcataaattttgcatttattcacaaggatagaaaaacattagcatctcct |
210 |
Q |
| |
|
|| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576062 |
aaagaagacccacattcttatagtgagtagctcttgccatgctatcttcatcataaattttgcatttattcacaaggatagaaaaacattagcatctcct |
10576161 |
T |
 |
| Q |
211 |
ggtggccaatgaattgcatatgcaccattata |
242 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
10576162 |
ggtggccaatgaattgcatatacaccattata |
10576193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University