View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11338_high_14 (Length: 311)
Name: NF11338_high_14
Description: NF11338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11338_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 162 - 271
Target Start/End: Original strand, 6932066 - 6932175
Alignment:
| Q |
162 |
agatttatacatacttctctcttatttcaccattaaggtgaataaatgttgttnnnnnnngttgaataagtgacggatccagcttctctctcatgattat |
261 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6932066 |
agatttatatatacttctctctcatttcaacattaaggtgaataaatgttgttaaaaaaagttgaataagtgacggatccagcttctctctcatgattat |
6932165 |
T |
|
| Q |
262 |
actgtctgaa |
271 |
Q |
| |
|
|||||||||| |
|
|
| T |
6932166 |
actgtctgaa |
6932175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 65
Target Start/End: Original strand, 6930596 - 6930631
Alignment:
| Q |
30 |
atggtccatgacacatattatttcttaaatttagtt |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6930596 |
atggtccatgacacatattatttcttaaatttagtt |
6930631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 95
Target Start/End: Original strand, 6931966 - 6932000
Alignment:
| Q |
61 |
tagttaaatattgatttttcactttttaatgtcaa |
95 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6931966 |
tagttaaatatagatttttcactttttaatgtcaa |
6932000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University