View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11339_low_10 (Length: 231)
Name: NF11339_low_10
Description: NF11339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11339_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 4097596 - 4097804
Alignment:
| Q |
17 |
gaagaaaacaaggagtagggaagcatatgatgtttcaagagatggtgtacctgtagataagttctaaaactttcatatcataatctgtaaaagcctttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
4097596 |
gaagaaaacaaggagtagggaagcatatgatgttacaagagatggtgtacctgtagataagttctaaaactttcatatgataatctgtaaaagcctttgt |
4097695 |
T |
 |
| Q |
117 |
tgttttatacaccattttaagtctttttgtatggttgggttgtgatttgagaaatgtggaaagtctctttagtatttgatgattatgatcaattaactgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4097696 |
tgttttatacaccattttaagtctttttgtatggttgggttgtgatttgagaaatgtggaaagtctctttagtattcgatgattatgatcaattaactgt |
4097795 |
T |
 |
| Q |
217 |
tgctgtttg |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
4097796 |
tgctgtttg |
4097804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 83
Target Start/End: Complemental strand, 25796594 - 25796528
Alignment:
| Q |
17 |
gaagaaaacaaggagtagggaagcatatgatgtttcaagagatggtgtacctgtagataagttctaa |
83 |
Q |
| |
|
|||||||||||||| |||||||| ||||| ||||| |||||||||||| | ||||||| |||||| |
|
|
| T |
25796594 |
gaagaaaacaaggaaaagggaagcttatgaagtttctagagatggtgtaattatagataaattctaa |
25796528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University