View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11339_low_7 (Length: 258)
Name: NF11339_low_7
Description: NF11339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11339_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 156 - 240
Target Start/End: Complemental strand, 32117930 - 32117846
Alignment:
| Q |
156 |
cgccaaggcaatgaaaacaggagaattgcttttggagttttgtatgttacatttcagcgcataccttttttatgtatgaccaaca |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32117930 |
cgccaaggcaatgaaaacaggagaattgtttttggagttttgtatgttacatttcagcgcataccttttttatgtatgaccaaca |
32117846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 32118043 - 32117924
Alignment:
| Q |
17 |
acctttgttctttgctttggttgcaagattcgtattgttatt--------ttttattctcacttgatattttagtaattgtgttgtgtttcttcttcgtg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32118043 |
acctttgttctttgctttggttgcaagattcgtattgtttttatttttatttttattctcacttaatattttagtaattgtgttgtgtttcttcttggtg |
32117944 |
T |
|
| Q |
109 |
gtagcatggtagccgccaag |
128 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
32117943 |
gtagcatggcagccgccaag |
32117924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University