View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11339_low_9 (Length: 239)
Name: NF11339_low_9
Description: NF11339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11339_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 31414704 - 31414925
Alignment:
| Q |
1 |
caataccttctttttgatgattctagcatgctgaaatctcatcaaccttttccaagccctaaaagtgacaatgatttagacacaactgtagaggcgcgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31414704 |
caataccttctttttgatgattctagcatgctgaaatctcatcaaccttttccaagccctaaaagtgacaatgatttagacacaactgtagaggcgcgtg |
31414803 |
T |
 |
| Q |
101 |
aagtaagaacgcctcctgtatggaagcggtacaagggagtgaggcgtaggccatgggggaagttcgcggctgagataagagatccaaaaaagaatggtgc |
200 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31414804 |
aagtaagcatgcctcctgtatggaagcggtacaagggagtgaggcgtaggccatgggggaagttcgcagctgagataagagatccaaaaaagaatggtgc |
31414903 |
T |
 |
| Q |
201 |
tagagtttggcttggaacgtat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31414904 |
tagagtttggcttggaacgtat |
31414925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 31410743 - 31410957
Alignment:
| Q |
1 |
caataccttctttttgatgattctagcatgctgaaatctcatcaaccttttccaagccctaaaagtgacaatgatttagacacaactgtagaggcgcgtg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||| | || | |||| ||||||||| |||||||||||||||||||||||| | |||||||| |||||||||||||| |
|
|
| T |
31410743 |
caataccttctttttgatgattccagctttctaacatcttatcaaccttctccaagccctaaaagtgacaatgagtcagacacaattgtagaggcgcgtg |
31410842 |
T |
 |
| Q |
101 |
aagtaagaacgcctcctgtatggaagcggtacaagggagtgaggcgtaggccatgggggaagttcgcggctgagataagagatccaaaaaagaatggtgc |
200 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31410843 |
aagtaaacacccctcccatatggaagcggtacaagggcgtgaggcgtaggccatgggggaagttcgcggcagagataagagatccaaaaaagaatggtgc |
31410942 |
T |
 |
| Q |
201 |
tagagtttggcttgg |
215 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
31410943 |
tagggtttggcttgg |
31410957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 120 - 215
Target Start/End: Original strand, 31407685 - 31407780
Alignment:
| Q |
120 |
atggaagcggtacaagggagtgaggcgtaggccatgggggaagttcgcggctgagataagagatccaaaaaagaatggtgctagagtttggcttgg |
215 |
Q |
| |
|
||||||||| |||| || |||||||||||||| ||||| ||||| || || ||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
31407685 |
atggaagcgttacagaggcgtgaggcgtaggccgtggggaaagtttgccgcagagataagagacccaaaaaagaatggtgctagggtttggcttgg |
31407780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 139 - 221
Target Start/End: Original strand, 1008563 - 1008645
Alignment:
| Q |
139 |
gtgaggcgtaggccatgggggaagttcgcggctgagataagagatccaaaaaagaatggtgctagagtttggcttggaacgta |
221 |
Q |
| |
|
|||||||| |||||||||||||| || || || |||||||| |||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
1008563 |
gtgaggcgaaggccatgggggaaatttgctgcagagataagggatccaaagaagaatggagctagagtttggcttggaacgta |
1008645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 188
Target Start/End: Complemental strand, 1002755 - 1002697
Alignment:
| Q |
130 |
tacaagggagtgaggcgtaggccatgggggaagttcgcggctgagataagagatccaaa |
188 |
Q |
| |
|
||||| ||||||||||| ||||| ||||| ||||| || |||||||| ||||||||||| |
|
|
| T |
1002755 |
tacaaaggagtgaggcggaggccttggggaaagtttgcagctgagattagagatccaaa |
1002697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University