View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_high_30 (Length: 264)
Name: NF1133_high_30
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_high_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 43 - 187
Target Start/End: Original strand, 46582485 - 46582629
Alignment:
| Q |
43 |
tcaatacctatgagggtaaatgaaactagcaccacttcacttcctgcaacacctatcaatactcagcaagaaactagacaagaagaacaatcttctcaga |
142 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582485 |
tcaatacctatgagagtaaatgaaactagcaccacttcacttcctgcaacacctatcaatactcagcaagaaactagacaagaagaacaatcttctcaga |
46582584 |
T |
|
| Q |
143 |
actctccacctaacacttgatttagtttctttgtgttacttgaag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46582585 |
actctccacctaacacttgatttagtttctttgtgctacttgaag |
46582629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 46582700 - 46582736
Alignment:
| Q |
205 |
gcactgattcatatagttacattcaatgaattcatct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582700 |
gcactgattcatatagttacattcaatgaattcatct |
46582736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University