View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_high_34 (Length: 252)
Name: NF1133_high_34
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_high_34 |
 | |
|
| [»] scaffold0259 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0259 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 19345 - 19107
Alignment:
| Q |
1 |
ccctttctttactgaatagacagttgagtattcaattttccaagtgaaatcataaaaaatgtcgtttctactttaacgaatttcattgtcaaatattaat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19345 |
ccctttctttattgaatagacagttgagtattcaattttccaagtgaaatcataaaaaatgtcgtttctactttaacgaatttcattgtcaaatat---- |
19250 |
T |
|
| Q |
101 |
atataaaaatggaaagtacgaatggaaaatataccatttaactcggcacacttttcttcaatttcatgtttgaactagagaatgtattcactactaacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19249 |
--ataaaaatggaaagtacgaatggaaaatataccatttaactcggcacacttttcttcaatttcatgtttgaactagagaatgtattcactactaacat |
19152 |
T |
|
| Q |
201 |
ccatgttatttaaagttgctgcaatatccatccctgtctctgctc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
19151 |
ccatgttatttaaagttgctgcaatatccgtccctgtctttgctc |
19107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 100 - 239
Target Start/End: Original strand, 49067279 - 49067418
Alignment:
| Q |
100 |
tatataaaaatggaaagtacgaatggaaaatataccatttaactcggcacacttttcttcaatttcatgtttgaactagagaatgtattcactactaaca |
199 |
Q |
| |
|
|||||| ||| |||| |||| |||| ||||||||||| || ||| ||||||| |||||||||||||||||| |||| ||||| |||||||| |||||| |
|
|
| T |
49067279 |
tatatataaacggaaggtactaatgaaaaatataccacctacctcagcacactgttcttcaatttcatgtttcaacttgagaacatattcactgctaaca |
49067378 |
T |
|
| Q |
200 |
tccatgttatttaaagttgctgcaatatccatccctgtct |
239 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
49067379 |
tccatgttatttaaagccgctgcaatatctgtccctgtct |
49067418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 31989857 - 31989772
Alignment:
| Q |
154 |
ttcttcaatttcatgtttgaactagagaatgtattcactactaacatccatgttatttaaagttgctgcaatatccatccctgtct |
239 |
Q |
| |
|
||||||||||| |||||| |||| ||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
31989857 |
ttcttcaatttgatgtttcaacttgagaacatattcactactaacatccatgttatttaaagcagttgcaatatccatccctgtct |
31989772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University