View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_high_36 (Length: 251)
Name: NF1133_high_36
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_high_36 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 3810325 - 3810090
Alignment:
| Q |
16 |
atcaggatcatctttagaaatatgagactttgcattgtcttgttgaatgaaaattgtcttccctacatcttctattggccagcaattcttaagggctggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810325 |
atcaggatcatctttagaaatatgagactttgcattctcttgttgaatgaaaattgtcttccctacatcttctattggccagcaattcttaagggctggt |
3810226 |
T |
 |
| Q |
116 |
aagattttgctcatcatgaaagttttattcacctctcttgtcacagaagttataggtttcctttctatagtccctgcagctctgttgacactgcttcttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810225 |
aagattttgctcatcatgaaagttttattcacctctcttgtcacagaagttataggtttcctttctatagtccctgcagctctgttgacactgcttcttc |
3810126 |
T |
 |
| Q |
216 |
tagctggctgttcatacacaaatggaaatataccaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810125 |
tagctggctgttcatacacaaatggaaatataccaa |
3810090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University