View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_high_43 (Length: 250)
Name: NF1133_high_43
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_high_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 22365446 - 22365667
Alignment:
| Q |
1 |
tcaagagagaagatagaatgaaaaccatttatgttgtgtggtagtgagtgcacacaaatcaaaccattttgatagatacaaattatatggtccgctcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
22365446 |
tcaagagagaagatagaatgaaaatcatttatgttgtgtggtagtgagtgcacacaaatcaaaccattttgatagacacatattatatggtccgctcttt |
22365545 |
T |
|
| Q |
101 |
ccgtcacataccatgaaagtggttctgacaaccgcaaattccacatatacctcgggcagttctcccctccccttgagatttctgctaatcaaatattgta |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
22365546 |
ccgccacataccatgaaagtggttctgacaaccgcaaattccacctatacctcgggcagttctcccctccccttgagatttctgctaatcatatatttta |
22365645 |
T |
|
| Q |
201 |
tcgctcatactcatttcaattt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
22365646 |
tcgctcatactcatttcaattt |
22365667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 2788717 - 2788754
Alignment:
| Q |
1 |
tcaagagagaagatagaatgaaaaccatttatgttgtg |
38 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2788717 |
tcaagagagaagatagaatgaaaaccattcatgttgtg |
2788754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University