View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_29 (Length: 364)
Name: NF1133_low_29
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 16 - 286
Target Start/End: Original strand, 15884975 - 15885248
Alignment:
| Q |
16 |
atgttctctcaattactttcgtggattagataaagnnnnnnnnnngcgtagacattattttacagtgagttggatcatgaaaatgtgaatttcatattca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
15884975 |
atgttctctcaattactttcgtggattagataaaagaaaaaaaatgcgtagacattattttacagtgagttggatcatgaaaatatgaatttcatgttca |
15885074 |
T |
 |
| Q |
116 |
tttttgtcttcacattatctctatttatagagaaaaacatgtcacttgtcaaagtgaa---acatcctttggatgagtttctacaatgtttttcgaacat |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15885075 |
tttttgtcttcacattgtctctatttatagagaaaaacatatcacttgtcaaagagaagaaacatcctttggatgagtttctacaatgtttttcgaacat |
15885174 |
T |
 |
| Q |
213 |
gtatatctatcccatggttttaaatcgcaattatggtcattgctcttgttgcgagcattgttgtgtgaagtgac |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15885175 |
gtatatctatcccatggttttaaatcgcaattatggtcattgctcttgttgcgagcattgttgtgtgaagtgac |
15885248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University