View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_55 (Length: 271)
Name: NF1133_low_55
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_55 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 31 - 223
Target Start/End: Original strand, 32801964 - 32802156
Alignment:
| Q |
31 |
ttattctatctattccaggaattgtgatggtgataatgataatgtaatgattgtgaggaaggagaaacggtttttaatggtacattgacatgagagattg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32801964 |
ttattctatctattccaggaattgtgatggtgataatgataatgtaatgattgtgaggaaggagaaacggtttttaatggtacattgacatgagagattg |
32802063 |
T |
|
| Q |
131 |
agacacccataccactcaattgaatatgaatatgatatgttagcacttttaggtcaaaaatggtgtctaggttgatgctgaatgttcatatat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
32802064 |
agacacccataccactcaattgaatatgaatatgatatgtaagcacttttaggtcaaaaatagtgtctatgttgatgctgaatgttcatatat |
32802156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University