View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_61 (Length: 263)
Name: NF1133_low_61
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 31 - 239
Target Start/End: Complemental strand, 44853900 - 44853692
Alignment:
| Q |
31 |
ggatatccatgtggatatggtggctgcacaaataacatttttatccaataaggagcacacatatatcatactatcggtccatggatatccatttacatat |
130 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44853900 |
ggatatccatgtggatatggtggcagcacatatatcatttttatccaataaggagcacacatatatcatactatcggtccatggatatccatttacatct |
44853801 |
T |
|
| Q |
131 |
atagtctcattatgtagaaaaccttatgatgctagtacttgtttaatttaaagaaaaatagtgaaacttgtgtctctcaatcgaaatatgcaaagataat |
230 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44853800 |
atagtctcattacgtaaaaaaccttatgatgctagtacttgtttaatttaaagaaaaatagtgaaacttgtatctctcaatcgaaatatgcaaagataac |
44853701 |
T |
|
| Q |
231 |
tggcagtat |
239 |
Q |
| |
|
||||||||| |
|
|
| T |
44853700 |
tggcagtat |
44853692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University