View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1133_low_64 (Length: 253)

Name: NF1133_low_64
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1133_low_64
NF1133_low_64
[»] chr2 (1 HSPs)
chr2 (122-199)||(34725866-34725943)


Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 199
Target Start/End: Original strand, 34725866 - 34725943
Alignment:
122 tgtaaaatggatttgtgcaagtattgtatactagggaaacaatgtcatatttagtttaagcccgagaaacacaaaatc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34725866 tgtaaaatggatttgtgcaagtattgtatactagggaaacaatgtcatatttagtttaagcccgagaaacacaaaatc 34725943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University