View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_68 (Length: 252)
Name: NF1133_low_68
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_68 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 675867 - 675645
Alignment:
| Q |
1 |
attaaacaaaactaaactacatagtctctaattttctactaacatgtaaatattgaaattgaaaatttttcatttatacataggttcttgnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
675867 |
attaaacaaaactaaactacatagtctctaattttctactaacatgtaaatattgaaattgaaaatttttcatttatacataggttcttgtttttttttt |
675768 |
T |
 |
| Q |
101 |
nnnnnnctcttcaaagaggaacataacataacaataagaataaaatcaaactccataaattattttcctcatagaatatgaaccctaatttctcaaagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
675767 |
ctttttctcttcaaagaggaacataacataacaataagaataaaatcaaactccataaattattttcctcatagaatatgaaccctaatttctcaaagtt |
675668 |
T |
 |
| Q |
201 |
tgttgttagttgaataaacttta |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
675667 |
tgttgttagttgaataaacttta |
675645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University