View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_74 (Length: 251)
Name: NF1133_low_74
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_74 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 144 - 247
Target Start/End: Original strand, 11436412 - 11436515
Alignment:
| Q |
144 |
gaaaatttggttgtgtgtgatttcttatcgtttatatcatgaatgcatgtttatctcacttggtggcaatttaaagtgtcaaatgcatgatccttttgaa |
243 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
11436412 |
gaaaattgggttgtgtgtgatttcttatcatttttatcatgaatgcatgtttatctcacttggaggcaatttaaagtgtcaaatgcatgatcctcgtgaa |
11436511 |
T |
|
| Q |
244 |
ctta |
247 |
Q |
| |
|
|||| |
|
|
| T |
11436512 |
ctta |
11436515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University