View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_75 (Length: 251)
Name: NF1133_low_75
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 11 - 192
Target Start/End: Complemental strand, 9334189 - 9334007
Alignment:
| Q |
11 |
cttttgttagtgctgttgttattttcttattattactgtcattacttttctttt------gttcttagaatattccaataaagatggtgagcatgaggtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9334189 |
cttttgttagtgctgttgttattttcttattattactgtcatcacttttctttttcttttgttcttagaatattccaataaagatagtgagcatgaggtt |
9334090 |
T |
|
| Q |
105 |
tggcaagttcgtgcaatcaccattctgttagaacccttgtggtaggcagtagagagaatagttttctctcaactgaggagcttaggct |
192 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9334089 |
tggcaagttcatacaatcaccattctgttagaac-----aggtaggcagtagagagaatagttttctctcaactgaggagcttaggct |
9334007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 8 - 192
Target Start/End: Complemental strand, 9328874 - 9328708
Alignment:
| Q |
8 |
tggcttttgttagtgctgttgttattttcttattattactgtcattacttttcttttgttcttagaatattccaataaagatggtgagcatgaggtttgg |
107 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
9328874 |
tggcttttgttattgctgctgttattttcttattattactgtcatcactcttcttttgttcttagaata--------aagatagtgagcatgagatttgg |
9328783 |
T |
|
| Q |
108 |
caagttcgtgcaatcaccattctgttagaacccttgtggtaggcagtagagagaatagttttctctcaactgaggagcttaggct |
192 |
Q |
| |
|
||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
9328782 |
caa----------tcaacattctgttagaacacttgtggtaggcagtagagagaatagttttctctcaaaagaggatcttaggct |
9328708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 189 - 249
Target Start/End: Complemental strand, 9333579 - 9333519
Alignment:
| Q |
189 |
ggcttgactcatgtgagagtgcaggttcttacattcactcttcatgatattcttggacatg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
9333579 |
ggcttgactcatgtgagagtgcaggttcttacattcactcttcatgattttgatggacatg |
9333519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University