View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_76 (Length: 251)
Name: NF1133_low_76
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 30 - 237
Target Start/End: Original strand, 4821146 - 4821357
Alignment:
| Q |
30 |
cattagactcgctttatgtatcatgctttatgtatcatatatatacaattgtacaaattttgacgtagaatgagaagaggtccatttctgcagcagattt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4821146 |
cattagactcgctttatgtatcatgctttatgtatcatacatatacaattgtacaaattttgacgtagaatgagaagaggtccatttctgcagcagattt |
4821245 |
T |
 |
| Q |
130 |
ctatcttttgatcgaccggatgcttgcacatggacctaattacccac----atatatgcagtgatttatgttatctcatttaacattttcattatggata |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4821246 |
ctatcttttgatcgaccggatgcttgcacatggaactaattacccacatatatatatgcattgatttatgttatctcatttaactttttcattatggata |
4821345 |
T |
 |
| Q |
226 |
catgatatctaa |
237 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4821346 |
catgatatctaa |
4821357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University