View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_77 (Length: 251)
Name: NF1133_low_77
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_77 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 35453187 - 35452933
Alignment:
| Q |
10 |
aagaatatattgactgggcttctaatattacgatggacttgggcttaatgagttcaaagttaaactatacttttagtattgcttttttggccccctcaat |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35453187 |
aagaaaatattgactgggcttctaatattacgatggacttgggcttaatgagttcaaagttaaactatacttttaggattgcttttttggccccctcaat |
35453088 |
T |
|
| Q |
110 |
gtcta-------------aaaatttgatagataactttcgaagaccagtttcttttagtttaacaccatcaaaatacatttggaaatcaatttacaacgt |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35453087 |
gtctatcaagcacctctaaaaatttgatagataactttcgaagaccagtttcttttagtttaacaccatcaaaatacatttggaaatcaatttacaacgt |
35452988 |
T |
|
| Q |
197 |
gttagtacatcaaatttttatattgcagttaaatttgtaaaaaactacaaacaaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35452987 |
gttagtacatcaaatttttatattgcagttaaatttgtaaaaaactactaacaaa |
35452933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University