View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_83 (Length: 245)
Name: NF1133_low_83
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_83 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 5472778 - 5472708
Alignment:
| Q |
1 |
tcctttcgaagaattaaagattctatcggttgatgatacctctaagatcactttccctaggcttgttagaa |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5472778 |
tcctttcgaagaattaaagattctatcggttgatgatacctctaagatcactttccctaggcttgttagaa |
5472708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 189 - 245
Target Start/End: Complemental strand, 5472552 - 5472496
Alignment:
| Q |
189 |
gacatcatatattttttaaaattcagtatttgatccaaaaatcgattaattggatgg |
245 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
5472552 |
gacatcatatatttttttaaattcagtatctgatccaaaaatcgattaatttgatgg |
5472496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University