View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1133_low_91 (Length: 209)
Name: NF1133_low_91
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1133_low_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 36 - 181
Target Start/End: Original strand, 35284544 - 35284689
Alignment:
| Q |
36 |
aggttgagagaagttcttgcaactaagagattaatattcaattagaagaaagcaaatgacagtgagtgagtgaactaagctggaactgtgaactttgcaa |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35284544 |
aggttgagagaagttcttgcaactaagagattaatattcaattagaagaaagcaaatgacagtgagtgagtaaactaagctggaactgtgaactttgcaa |
35284643 |
T |
 |
| Q |
136 |
ataagtaaccaacttcctaactaccttttaacagattcaactaact |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35284644 |
ataagtaaccaacttcctaactaccttttaacagattcaactaact |
35284689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University