View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1133_low_92 (Length: 202)

Name: NF1133_low_92
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1133_low_92
NF1133_low_92
[»] chr4 (1 HSPs)
chr4 (1-119)||(55954262-55954380)


Alignment Details
Target: chr4 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 55954262 - 55954380
Alignment:
1 tgtatcgcatctgctgcacaacgttggatagtgttacattttaatttatacaaaaagtctagaatatgacaacaaaatatgattgtattgtagttgcaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55954262 tgtatcgcatctgctgcacaacgttggatagtgttacattttaatttatacaaaaagtctagaatatgacaacaaaatatgattgtattgtagttgcaga 55954361  T
101 ggatctatgtttgcaaaat 119  Q
    |||||||||||||||||||    
55954362 ggatctatgtttgcaaaat 55954380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University