View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11340_low_7 (Length: 265)
Name: NF11340_low_7
Description: NF11340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11340_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 20 - 165
Target Start/End: Original strand, 10299110 - 10299255
Alignment:
| Q |
20 |
agtaaagtgtgatatatcaccatttaaannnnnnnnatctaaatatttcatgtgttttttcttttcatgaacgatgatacatcatactttgcactctgat |
119 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10299110 |
agtaaagtgtgatttatcaccatttaaattttttttatctaaatatttcatgtgttttttcttttcatgaacgatgatacatcatactttgcactctgat |
10299209 |
T |
|
| Q |
120 |
gtataaattacatattagaggattcaatccacccttctcccacaac |
165 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
10299210 |
gtataaattacatattagaggattcattccacccttctccaacaac |
10299255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University