View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11342_high_25 (Length: 250)
Name: NF11342_high_25
Description: NF11342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11342_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 7266863 - 7266640
Alignment:
| Q |
15 |
aatctcaacctcaatacgctctgcactcgatacacctctcaactacgcgcgaaattacctctctaatcttcttccaaactgcgttcgcaaaatcgtttac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
7266863 |
aatctcaacctcaatacgctctgcactcgatacacctctcaactacgcgcgaaattacctctctaaccttcttccaaactgtgttcacaaaatcgtttac |
7266764 |
T |
|
| Q |
115 |
cttgattctgatctcattcttgtcgatgatatcgcaaaactcgctgcaacgaatttcacaaacgaagccgttttagctgcacctgaatactgcaacgcga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7266763 |
cttgattctgatctcattcttgtcgatgatatcgcaaaactcgctgcaacgaatctcacaaacgaagccgttttagctgcacctgaatactgcaacgcga |
7266664 |
T |
|
| Q |
215 |
atttcagttactattttaccccta |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7266663 |
atttcagttactattttaccccta |
7266640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University