View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11342_high_30 (Length: 206)
Name: NF11342_high_30
Description: NF11342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11342_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 24 - 129
Target Start/End: Complemental strand, 32266822 - 32266717
Alignment:
| Q |
24 |
tttgtgttgctgctacaacaatgaatctaaggaaatctaagagaagagttaggttcaagtctattactctttcaaatcatcaaccttcttcttcttctgt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32266822 |
tttgtgttgctgctacaacaatgaatctaaggaaatctaagagaagaattaggttcaagtctattactctttcaaatcagcaaccttcttcttcttctgt |
32266723 |
T |
 |
| Q |
124 |
taatgg |
129 |
Q |
| |
|
|||||| |
|
|
| T |
32266722 |
taatgg |
32266717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University