View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11342_high_31 (Length: 206)
Name: NF11342_high_31
Description: NF11342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11342_high_31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 11623570 - 11623365
Alignment:
| Q |
1 |
gcagaaaagtcacatcgaaaattcacatagtattgcatcaactaacttgacaatctacaatatgacatgctaatctatatttacactgtctgggagattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11623570 |
gcagaaaagtcacatcgaaaattcacatagtattgcatcaattaacttgacaatctacaatatgacatgctaatctatatttacactgtctgggagattc |
11623471 |
T |
 |
| Q |
101 |
ttaagcattcaaatggctcaaaaattagttatatatgtggtatgtaacctacacatgagggttatgatgcatacatctagacaaagaaccatcatcgagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11623470 |
ttaagcattcaaatggctcaaaaattagttatatatgtggtatgtaacctacacatgagggttatgatgcatacatctagacaaagaaccatcattgagc |
11623371 |
T |
 |
| Q |
201 |
taccca |
206 |
Q |
| |
|
|||||| |
|
|
| T |
11623370 |
taccca |
11623365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University