View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11342_low_19 (Length: 351)
Name: NF11342_low_19
Description: NF11342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11342_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 33537861 - 33538176
Alignment:
| Q |
1 |
ctgggatattgcaggattggcgcacactctgcagaatcgcacacagatactttcttcgactgatcaagtaatgctgcacatttgttctagagagacggaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
33537861 |
ctgggatattgtaggattggcgcacactctgcagaatcgcacacagatactttcttcgactgatcaagtgatgctggacatttgttctagagagacggaa |
33537960 |
T |
 |
| Q |
101 |
gatgctgttagtcgtgcattacttctgtaatgtaatagtagcaatgcagcaattcgatttattttcttttcattttgtttatgtaggtcttgggaataaa |
200 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
33537961 |
gatgttgttagttgtgcattacttctgtaatgtaatagtagcaatgcagcaattcgatttattttcttttcattttgtttatttaggtcttaggaataaa |
33538060 |
T |
 |
| Q |
201 |
tacttaccactatgagaggcttatcacgagtacttttttcatccaccctatcattttttaatcatactattttgaaaacctactttcattaaaagttcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33538061 |
tacttaccactatgagaggcttattacgagtacttttttcatccaccctatcattttttaatcatactattttgaaaacctactttcattaaaagttcaa |
33538160 |
T |
 |
| Q |
301 |
aagttagctgagttat |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33538161 |
aagttagctgagttat |
33538176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University