View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11342_low_24 (Length: 321)
Name: NF11342_low_24
Description: NF11342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11342_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 30850821 - 30850524
Alignment:
| Q |
1 |
tttgctagatagcttttatcactatttaaaacagatagacattaccaaaccacacataatatgatattatttttatagtctcgatggacacatatgcata |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30850821 |
tttgctagatagcttttgtcactatttaaaacagatagacattaccaaaccacacataatatgatattatttttatagtctcgatggacacatatgcata |
30850722 |
T |
 |
| Q |
101 |
ttgaaagcccttctagttttaacttaacactcaacacctaggaaaaggagttccacaagtgttagcaactttcctggcattaggagtgttaacaaacttc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30850721 |
ttgaaagcccttctaggtttaacttaacactcaacacctaggaaaaggagttccacaagtgttagcaactttcctggcattaggagtgttaacaaacttc |
30850622 |
T |
 |
| Q |
201 |
ctaagattgggattcttcatgtattggcaaaggcaaggtctttgttctttgattttggagcagcataggttagatggaggagttgaagatgtgattgc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30850621 |
ctaagattgggattcttcatgtattggcaaaggcaaggtctttgttctttgattttggagcagcataggttagatggaggagttgaagatgtgattgc |
30850524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University