View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11342_low_33 (Length: 222)
Name: NF11342_low_33
Description: NF11342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11342_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 11622752 - 11622969
Alignment:
| Q |
1 |
aatatccttctacatcccacgtgtttagtcaaaaagagtctcgaagcaagtcaccgggtcacagaagaagacctagtgatgcagaaagatgtagtgtgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
11622752 |
aatatccttctacatcccacgtgtttagtcgaaaagagtctcgaagcaagtcactgggtcacagaagaagacctagtgttgcagaaagatgtagtgtatc |
11622851 |
T |
|
| Q |
101 |
tccagatgtggcaacagagcttgagcttaagatgcctggatcatcaacacaacaggtatattataaacaatttatatatatcttaaaaatccaaacttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11622852 |
tccagatgtggcaacagagcttgagcttaagatgcctggatcatcaacacaacaggtatattataaacaatttatatatatcttaaaaatccaaacttgt |
11622951 |
T |
|
| Q |
201 |
ttcagtgctaaaacttac |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
11622952 |
ttcagtgctaaaacttac |
11622969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University