View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11345_low_3 (Length: 496)
Name: NF11345_low_3
Description: NF11345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11345_low_3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 207 - 496
Target Start/End: Original strand, 17196414 - 17196703
Alignment:
| Q |
207 |
ccctaaccggcaagagagagaaggccaaacgaggttatgattagcgagccaatcataaagaacaggaacaagagatttccattgagagtacttctcatca |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17196414 |
ccctaaccggcaagagagagaaggccaaacgaggttatgattagcaagccaatcataaagaacaggaacaagagatttccattgagagtacttctcatca |
17196513 |
T |
 |
| Q |
307 |
acagaagcttgttgttgctgctgctgatgaagctgttgctgttgcttttccttcttcgattctctcggtgtcttcacttgtgatggttcttctctcttgt |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17196514 |
acagaagcttgttgttgctgctgctgatgaagctgttgctgttgcttttccttcttcgattctctcggtgacttcacttgtgatggttcttctctcttgt |
17196613 |
T |
 |
| Q |
407 |
cttccttgggtttaggtttgcgtcctcttgtctccttcttcttcacggcgccggttgagggtggtgtctccatttctcacgctctgtgct |
496 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17196614 |
cttccttgggtttaggtttgcgtcctcttgtctccttcttcttcacggcgccggttgagggtggtgtctccatttctcactctctgtgct |
17196703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University