View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11348_low_5 (Length: 260)
Name: NF11348_low_5
Description: NF11348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11348_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 19 - 155
Target Start/End: Original strand, 34006718 - 34006854
Alignment:
| Q |
19 |
tctcgaacgtaacattgtgaagccctaagctgatgacctaattcattgcattccaaagacccatataacctcctccccttcatgaattgctagtagcata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34006718 |
tctcgaacgtaacattgtgaagccctaagctgatgacctaattcattgcattccaaagacccatataacctcatccccttcatgaattgctagtagcata |
34006817 |
T |
|
| Q |
119 |
tatacgaccaacctgttagagctgaactgttctcacc |
155 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34006818 |
tatacaaccaacctgttagagctgaactgttctcacc |
34006854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 181 - 258
Target Start/End: Original strand, 34006852 - 34006929
Alignment:
| Q |
181 |
accatagctggtcaagttcaaaatacttacgtagtcttacgattgcttctagaaaattaatttgttcttctctctcga |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
34006852 |
accatagctggtcaagttcaaaatacttacgtagtcttatgattgcttctagaaaattaatttgtttttcactctcga |
34006929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University