View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11349_high_1 (Length: 451)
Name: NF11349_high_1
Description: NF11349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11349_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 3e-46; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 294 - 424
Target Start/End: Complemental strand, 30758259 - 30758129
Alignment:
| Q |
294 |
taacgcaacgggaatatgacaaggctttggaggaatgtcagcggaaactccaccaacagatggtccttaacaagggggacaagtcgtatatatcactgga |
393 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30758259 |
taacgcaacgggagtatgacaaggctttggaggaatgtcagtggaaactccatggacagttggtccttaacaagggggacaagtcgtatatatcactgaa |
30758160 |
T |
|
| Q |
394 |
tttatcaaagcaatggtaaacgagtcatcaa |
424 |
Q |
| |
|
| ||||||||||||||||||||| ||||||| |
|
|
| T |
30758159 |
tatatcaaagcaatggtaaacgactcatcaa |
30758129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 294 - 378
Target Start/End: Complemental strand, 30770009 - 30769925
Alignment:
| Q |
294 |
taacgcaacgggaatatgacaaggctttggaggaatgtcagcggaaactccaccaacagatggtccttaacaagggggacaagtc |
378 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
30770009 |
taacgcaacgggagtatgacaaggctttggaggaatgtcagcggaaactccatggacagatggtcgttaacatgggggacaagtc |
30769925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 30772667 - 30772611
Alignment:
| Q |
30 |
actcatcttttccattgaaaatttccaccggtcattatccatacactctcctctcta |
86 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
30772667 |
actcatcttttccattgaaaatttccacctgtcatattccatacactctcctctcta |
30772611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 294 - 342
Target Start/End: Complemental strand, 30769813 - 30769765
Alignment:
| Q |
294 |
taacgcaacgggaatatgacaaggctttggaggaatgtcagcggaaact |
342 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30769813 |
taacgcaacgggagtatgacaaggctttggaggaatgtcagtggaaact |
30769765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 254 - 294
Target Start/End: Complemental strand, 30770855 - 30770815
Alignment:
| Q |
254 |
gattagtgttgttatctatacctggcgctgattgtgcttgt |
294 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30770855 |
gattagtgttgttatctatacctggtgctgattgtgcttgt |
30770815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University