View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11349_high_3 (Length: 340)
Name: NF11349_high_3
Description: NF11349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11349_high_3 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 72 - 340
Target Start/End: Complemental strand, 3480210 - 3479942
Alignment:
| Q |
72 |
gcagaacctgtgtttagcaaggcaggagaaacaattggagtaaaccatatgggaatggaaataaccgatcaggtaaaaattgttattttgcttttcgaag |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3480210 |
gcagaacctgtgtttagcaaggcaggagaaacaattggagtaaaccatatgggaatggaaataaccgatcaggtaaaaattgttattttgctttttgaag |
3480111 |
T |
|
| Q |
172 |
ttacttgcattgtcttaaaattttggttgggcttaactcatccaatgtaaggtgtgagctgctccgacttattataaacaaatttacaagcaatatctca |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3480110 |
ttacttgcattgtcttaaaattttggttgggcttaactcatccaatgtaaggtgtgagctgccccgacttattataaacaaatttacaagcaatatctca |
3480011 |
T |
|
| Q |
272 |
tccaatgtgatctatgaagtgtgactcgagtgacccgatatcaggccactaaggtcacgctttagatat |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3480010 |
tccaatgtgatctatgaagtgtgactcgagtgacccgatatcaggccactaaggtcactctttagatat |
3479942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 74 - 161
Target Start/End: Complemental strand, 3455606 - 3455519
Alignment:
| Q |
74 |
agaacctgtgtttagcaaggcaggagaaacaattggagtaaaccatatgggaatggaaataaccgatcaggtaaaaattgttattttg |
161 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3455606 |
agaacctgtgtttagcaaggcaggtgaaacaattggagtaaactatatgggaatggaaataacagatcaggtaaatattgttattttg |
3455519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 12242546 - 12242517
Alignment:
| Q |
1 |
cgtgtcgtgtccggtgtccgtgcttcatag |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12242546 |
cgtgtcgtgtccggtgtccgtgcttcatag |
12242517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 13414462 - 13414423
Alignment:
| Q |
1 |
cgtgtcgtgtccggtgtccgtgcttcatagatattcatca |
40 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13414462 |
cgtgtcgtgtctggtgtccgtgcttcatagatattcatca |
13414423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 74 - 148
Target Start/End: Original strand, 48694740 - 48694814
Alignment:
| Q |
74 |
agaacctgtgtttagcaaggcaggagaaacaattggagtaaaccatatgggaatggaaataaccgatcaggtaaa |
148 |
Q |
| |
|
||||||||| || ||||||||||| |||||||||||| | || | ||||||||||| |||||||||||||||| |
|
|
| T |
48694740 |
agaacctgtattcagcaaggcaggtgaaacaattggaatcaattacatgggaatggatgtaaccgatcaggtaaa |
48694814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 30
Target Start/End: Original strand, 41961725 - 41961753
Alignment:
| Q |
2 |
gtgtcgtgtccggtgtccgtgcttcatag |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41961725 |
gtgtcgtgtccggtgtccgtgcttcatag |
41961753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 241579 - 241548
Alignment:
| Q |
1 |
cgtgtcgtgtccggtgtccgtgcttcatagat |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
241579 |
cgtgtcgtgtccggtgtccgtgcttcatagat |
241548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 38804617 - 38804646
Alignment:
| Q |
1 |
cgtgtcgtgtccggtgtccgtgcttcatag |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38804617 |
cgtgtcgtgtccggtgtccgtgcttcatag |
38804646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 34595119 - 34595090
Alignment:
| Q |
1 |
cgtgtcgtgtccggtgtccgtgcttcatag |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34595119 |
cgtgtcgtgtccggtgtccgtgcttcatag |
34595090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University