View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11349_low_3 (Length: 317)
Name: NF11349_low_3
Description: NF11349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11349_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 7 - 310
Target Start/End: Complemental strand, 24266997 - 24266694
Alignment:
| Q |
7 |
ataaaaaatgtcatcaatattagcaaaggtgttgatggagctgctgctagaaattacttggtgcagggttatgccgaacttgctgcggaagttaatactg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24266997 |
ataaaaaatgtcatcaatattagcaaaggtgttgatggagctgctgctagaaattacttggtgcagggttatgccgaacttgctgcggaagttaatactg |
24266898 |
T |
 |
| Q |
107 |
ttggtttgaggttgggaactttggtttcggcttttggatcggtttttggatgtgggtctttggttatggctttggttgatttggttcagattaagttggg |
206 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24266897 |
ttggtttgagattgggaactttagtttcggcttttggatcggtttttggatgtgggtttttggttatggctttggttgatttggttcagattaagttggg |
24266798 |
T |
 |
| Q |
207 |
aactttggcttgtgggagtcattttactttggctgctgttgctcctttgctttttcttgttcctactgcgttacttatctatgttattcttgtcctctct |
306 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24266797 |
aactttggcttgtgggagtcattatactttggctgctgttgctcctttgctttttcttgttcctactgcgttacttatctatgttattcttgtcctctat |
24266698 |
T |
 |
| Q |
307 |
gctt |
310 |
Q |
| |
|
|||| |
|
|
| T |
24266697 |
gctt |
24266694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University