View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_15 (Length: 366)
Name: NF1134_low_15
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_15 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 289
Target Start/End: Original strand, 28764576 - 28764838
Alignment:
| Q |
21 |
gattgatgtgttactcagtaaacgacatatggataagggtacgaaacaacgattatcatcatatgagagtacatatgttagatatgttagtaatagttgc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| || ||||||| |
|
|
| T |
28764576 |
gattgatgtgttactcagtaaacgacatatggataagggtacgaaccaacgattatcatcgtatgagagtacatatgttag---------tagtagttgc |
28764666 |
T |
|
| Q |
121 |
ctttttcgt---tgtgattgctgaaggtgtaattcaacgaaggtgggactggagatgagggtgttccaagacttgcaaacgcactttagttgcataagag |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28764667 |
ctttttcgtcgttgtgattgctgaaggtgtaattcaacgaaggtgggaccggagatgagggtgttccaagacttgcaaacgcactttagttgcataagag |
28764766 |
T |
|
| Q |
218 |
atttaacaggaagcaataataagacctgagtgaacaggtcatcatggaggattaacggtgatattattcgac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
28764767 |
atttaacaggaagcaataataagacctgggtgaacaggtcatcatggaggattaacggtgataatcttcgac |
28764838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 28764579 - 28764551
Alignment:
| Q |
1 |
aatcacccttgactgccgtagattgatgt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28764579 |
aatcacccttgactgccgtagattgatgt |
28764551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 168 - 230
Target Start/End: Original strand, 5437679 - 5437741
Alignment:
| Q |
168 |
ggagatgagggtgttccaagacttgcaaacgcactttagttgcataagagatttaacaggaag |
230 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| | |||||||||| ||||||||||||| |
|
|
| T |
5437679 |
ggagatgagggtgttccatgacttgcaaacacacttcatttgcataagatatttaacaggaag |
5437741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 169 - 230
Target Start/End: Complemental strand, 553804 - 553743
Alignment:
| Q |
169 |
gagatgagggtgttccaagacttgcaaacgcactttagttgcataagagatttaacaggaag |
230 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||| | | |||||||| ||| ||||||||| |
|
|
| T |
553804 |
gagatgagggtgttccatgatttgcaaacacacttcattcgcataagatattcaacaggaag |
553743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 230
Target Start/End: Complemental strand, 18325484 - 18325428
Alignment:
| Q |
174 |
gagggtgttccaagacttgcaaacgcactttagttgcataagagatttaacaggaag |
230 |
Q |
| |
|
|||||||||||| || || ||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
18325484 |
gagggtgttccatgatttacaacagcactttagttgcataagagatttcacaggaag |
18325428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 161148 - 161095
Alignment:
| Q |
168 |
ggagatgagggtgttccaagacttgcaaacgcactttagttgcataagagattt |
221 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||| | |||||||||||||| |
|
|
| T |
161148 |
ggagattagggttttccaagacttgcaaacacacttcatctgcataagagattt |
161095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University