View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_23 (Length: 317)
Name: NF1134_low_23
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_23 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 79 - 317
Target Start/End: Complemental strand, 12415462 - 12415225
Alignment:
| Q |
79 |
aatatcatgaaaataccataacattctttcagcgaatgccattaagttcacaagaagctatcctaaacaaattgcaagatttttcggaaaagtatatccg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12415462 |
aatatcatgaaaataccataacattctttcagcgaatgccattaagttcacaagaagctatcctaaacaaattgcaagatttttgggaaaagtatatccg |
12415363 |
T |
|
| Q |
179 |
atgtgtatatcaccctacaaaacttaataacttgctcaagaattacacttgctcacttctcttggatttgggtgcttctaccaccagaccattannnnnn |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12415362 |
atgtgtatatcaccctacaaaacttaataacttgctcaagaattacactcgctcacttctcttggatttgggtgcttctaccaccagacca-tatttttt |
12415264 |
T |
|
| Q |
279 |
nnatcaatgtcttcactagaccaaacagtggataaccaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12415263 |
ttatcaatgtcttcactagaccaaacagtggataaccaa |
12415225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University