View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_25 (Length: 307)
Name: NF1134_low_25
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 105 - 183
Target Start/End: Original strand, 33885833 - 33885911
Alignment:
| Q |
105 |
caaacaaccttgtttgattcttttcttttttgtgtgactctttaatgcattcttaagtgtagctgattttgaatattgt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33885833 |
caaacaaccttgtttgattcttttcttttttgtgtgactctttaatgcattcttaagtgtagctgattttgaatattgt |
33885911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University