View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_26 (Length: 301)
Name: NF1134_low_26
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 102 - 190
Target Start/End: Complemental strand, 41238455 - 41238367
Alignment:
| Q |
102 |
gatttggtcaactagctcaactcttttgatgtgttgaagatctatgatggggatggtggtgaagctggattcatgagtaggtgaatttt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41238455 |
gatttggtcaactagctcaactcttttgatgtgttgaagatctatgatggggatggtggtgaagctggattcatgagtaggtgaatttt |
41238367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University