View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_30 (Length: 251)
Name: NF1134_low_30
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_30 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 31 - 251
Target Start/End: Complemental strand, 45584407 - 45584187
Alignment:
| Q |
31 |
tatgcacaaaggtatgaaaaattaaaaattcaaatgcaggtaatccaaatactagttacttaattgagttgccaagaatttgacatatcattatgcacat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45584407 |
tatgcacaaaggtatgaaaaattaaaaattcaaatgcaggtaatccaaatactagttacttaattgagttgccaagaatttgacatatcattatgcacat |
45584308 |
T |
|
| Q |
131 |
tttggcttgaactttagagaaggattagttcccgtacatacgtgtgtatatatctttcacattccttattccaaacctttatttatttacatatatgaca |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45584307 |
tttggcttgaactttagagaaggattagttcccgtacttacgtgtatatatatctttcacattccttattccaaccctttatttatttacatatatgaca |
45584208 |
T |
|
| Q |
231 |
aattttgagactctcagtgca |
251 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45584207 |
aattttgagactctcagtgca |
45584187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University