View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_31 (Length: 248)
Name: NF1134_low_31
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 12 - 174
Target Start/End: Original strand, 35529300 - 35529461
Alignment:
| Q |
12 |
acagatccgataaaagaatttaaacaagaactcacggcttgcgtcgagatgaccatccagcgtgagcttcaaacatagaagcactaaccacttcattgca |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35529300 |
acagatccgataaaagaatttaaataagaactcacggcttgcgtcgagatgaccatccagcgtgagcttcaaacttagaagcactaaccacttcattgca |
35529399 |
T |
|
| Q |
112 |
acaggtacaaaaaattccatatccctttttgtaaccttccaatagtttctgagcagcaccaca |
174 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
35529400 |
acagttacaaaaaattccatatcccttcttgtaaccttccaatagtttctgagc-gcaccaca |
35529461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 166
Target Start/End: Original strand, 35536776 - 35536926
Alignment:
| Q |
16 |
atccgataaaagaatttaaacaagaactcacggcttgcgtcgagatgaccatccagcgtgagcttcaaacatagaagcactaaccacttcattgcaacag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
35536776 |
atccgataaaagaatttaaacaagaactcacggcttgcgtcgagatgaccatccagcgtgagattcaaacttagaagcactaaccactgcattgcaacag |
35536875 |
T |
|
| Q |
116 |
gtacaaaaaattccatatccctttttgtaaccttccaatagtttctgagca |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35536876 |
gtacaaaaaattccatatccctttttgtaacctaccaatagtttctgagca |
35536926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 40 - 163
Target Start/End: Original strand, 35577065 - 35577188
Alignment:
| Q |
40 |
aactcacggcttgcgtcgagatgaccatccagcgtgagcttcaaacatagaagcactaaccacttcattgcaacaggtacaaaaaattccatatcccttt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||| || |||||| || | |||||||| ||||||| ||||||||||||||| |
|
|
| T |
35577065 |
aactcacggcttgcgtcgagatgaccatccagcatgagcttcaaacgtagaggcgctaacctctgtactgcaacagctacaaaagattccatatcccttt |
35577164 |
T |
|
| Q |
140 |
ttgtaaccttccaatagtttctga |
163 |
Q |
| |
|
|||||||| | |||||||||||| |
|
|
| T |
35577165 |
ttgtaaccgactaatagtttctga |
35577188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 171 - 227
Target Start/End: Original strand, 10970935 - 10970991
Alignment:
| Q |
171 |
cacagaaaaacacaaacacacagactacagaattattgacgaacaacttcgtagcat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10970935 |
cacagaaaaacacaaacacacagactacagaattattgacgaacaacttcgtagcat |
10970991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University