View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_37 (Length: 231)
Name: NF1134_low_37
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 141 - 207
Target Start/End: Complemental strand, 31201644 - 31201578
Alignment:
| Q |
141 |
aatatcttcgggataaacaagagaatggccagcaagtgaaagtgagattatatcaacaccatcacta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31201644 |
aatatcttcgggataaacaagagaatggccagcaagtgaaagtgagattatatcaacaccatcacta |
31201578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 11616572 - 11616623
Alignment:
| Q |
1 |
tgaaaagttttaacaattctaattaagaatgaacctttttttattacattat |
52 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| |||||| ||||||||| |
|
|
| T |
11616572 |
tgaaaagttttaactattctaattaagtatgaaccattttttcttacattat |
11616623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 11633663 - 11633612
Alignment:
| Q |
1 |
tgaaaagttttaacaattctaattaagaatgaacctttttttattacattat |
52 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| |||||| ||||||||| |
|
|
| T |
11633663 |
tgaaaagttttaactattctaattaagtatgaaccattttttcttacattat |
11633612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University