View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_38 (Length: 228)
Name: NF1134_low_38
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 41 - 145
Target Start/End: Original strand, 21181071 - 21181175
Alignment:
| Q |
41 |
ataagtcagaaaatttgtaatgcttaacggatcatatgagttacgttatgactcgagttagttgcaacttgaactagttttacttcttacctttcctcct |
140 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21181071 |
ataagtcagaaaattggtaatgcttaacggatcatatgagttacgttatgactcgagttagttgcaacttgaactagttttacttcttacctttcctcct |
21181170 |
T |
|
| Q |
141 |
atgct |
145 |
Q |
| |
|
|||| |
|
|
| T |
21181171 |
ttgct |
21181175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University