View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1134_low_42 (Length: 223)

Name: NF1134_low_42
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1134_low_42
NF1134_low_42
[»] chr4 (1 HSPs)
chr4 (16-95)||(40063401-40063480)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 16 - 95
Target Start/End: Complemental strand, 40063480 - 40063401
Alignment:
16 agtatttctcatttacgcttcagtagtgttggtcacatccattgattcattgcgtgcgtcagtgtatatatatgtaagta 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40063480 agtatttctcatttacgcttcagtagtgttggtcacatccattgattcattgcgtgcgtcagtgtatatatatgtaagta 40063401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University