View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_50 (Length: 205)
Name: NF1134_low_50
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 1977870 - 1978011
Alignment:
| Q |
1 |
aagcactttcaaaggtcttgatacaaccctgttgagtgatttcatgggtcctttgatatgttttgaaagaatcctccatatttcatcgaatggttgctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1977870 |
aagcactttcaaaggtcttgatacaaccctgttgagtgatttcatgggtcctttgatatgttttgaaagaatcctccatatttcattgaatggttgctta |
1977969 |
T |
|
| Q |
101 |
acataactagactcaccttttgaattttcatcttcacctttg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1977970 |
acataactagactcaccttttgaattttcatcttcacctttg |
1978011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 1948539 - 1948395
Alignment:
| Q |
1 |
aagcactttcaaaggtcttgatacaa---ccctgttgagtgatttcatgggtcctttgatatgttttgaaagaatcctccatatttcatcgaatggttgc |
97 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||| || ||||||||||||||||||| ||||||| || || ||| |
|
|
| T |
1948539 |
aagcactttcaaaggtcttgatacaagaacccttttgagtgatttcatgggtcctttgttaagttttgaaagaatcctccaaatttcattgagtgattgt |
1948440 |
T |
|
| Q |
98 |
ttaacataactagactcaccttttgaattttcatcttcacctttg |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1948439 |
ttaacataactagactcaccttttgaattttcatcttcacctttg |
1948395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University